BBa_K1362453 1 TEV clv. TEV protease recognition/cleavage site 2014-10-07T11:00:00Z 2015-05-08T01:10:06Z Tobacco Etch Virus This part codes for the amino acid sequence ENLYFQG. This site is recognized by TEV protease (catalytic domain of the Tobacco Etch Virus nuclear inclusion a (NIa) protein), which will cleave the Gln-Gly peptide bond [[{{PAGENAME}}:Design#References|[1]]]. The final four nucleotides of this sequence are GGGT, which will be the overhang produced wenn a reverse-facing BsaI site (<partinfo>BBa_K1362423</partinfo>, <partinfo>BBa_K1362427</partinfo>, <partinfo>BBa_K1362447</partinfo>) is directly following this part, as in the Sortase A circularization constructs (<partinfo>BBa_K1362202</partinfo>, <partinfo>BBa_K1362203</partinfo>, <partinfo>BBa_K1362204</partinfo>, <partinfo>BBa_K1362205</partinfo>). false false _1738_ 0 22951 9 In stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362453_sequence 1 gaaaacctgtacttccagggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z