BBa_K1362999 1 BBa_K1362999 iGEMHD tag 2014-10-07T11:00:00Z 2015-05-08T01:10:06Z Directly synthesized as an oligo as backtranslated with EMBOSS[1]. ==References== 1. Rice, P., Longden, I. & Bleasby, A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 16, 276???7 (2000). This Part adds ultimate coolness to you your part. More seriously, it served us as a random sequence being a better overlap site for CPEC cloning than the RFC[10] suffix. false false _1738_ 0 22830 9 Not in stock false We aimed for a sequence without secondary structures, balanced GC content. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Büscher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schäfer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2400473 1 stop range2400473 1 21 23 annotation2400472 1 stop range2400472 1 24 26 annotation2400474 1 iGEMHD range2400474 1 3 20 BBa_K1362999_sequence 1 aaatcggtgaaatgcacgactgatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z