BBa_K1363002 1 BBa_K1363002 HfiA the Inhibitor of synthesis of polysaccharose 2014-09-30T11:00:00Z 2015-05-08T01:10:06Z It comes from the genome of Caulobacter crescentus. HfiA is an inhibitor in the holdfast's polysaccharide synthesis pathway.It can inhibit one of the Hfs protein family-HfsJ.So it can block up the synthesis of polysaccharide.Without the polysaccharide,Caulobacter crescentus can hardly stick to the surface.We use this principle to regulate the Caulobacter crescentus's movement. false false _1739_ 0 18849 9 It's complicated false The sequence of HfiA doesn't contain any standrad restriction site. false Bo Dong BBa_K1363002_sequence 1 gtgtcgggccatttattgagcgcggacaggatgttgtcagtgagccgagcccttgatcaacgaccggagtcgcccagcctggtgatcgccaccacgatcctccagcttggcctcgttgttgtggtttggctggtggcgctgatccccgccgcgctggcggcgttaacgatgctggccgtgacattggcgcgcggcgcgtttcgccgctcgaagatcggccgcgccccccgccgctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z