BBa_K1363005 1 BBa_K1363005 R0082-HfiA the HfiA protein express passway which can be regulated by light 2014-10-01T11:00:00Z 2015-05-08T01:10:06Z BBa_R0082 BBa_K1363002 We add an OmpR promoter to the HfiA coding sequence to make it can be regulated by the red and blue upstream photosensitive elements.When there is no light,HfiA expresses and the systhesis of polysaccharose is inhibited.When there is red or blue light,the inhibition is removed and the holdfast is compounded normally. false false _1739_ 0 18849 9 It's complicated true It is not easy to get the BBa_K1363002 and we designed several primers. false Bo Dong BBa_K1363005_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggactaaagaggagaaagtgtcgggccatttattgagcgcggacaggatgttgtcagtgagccgagcccttgatcaacgaccggagtcgcccagcctggtgatcgccaccacgatcctccagcttggcctcgttgttgtggtttggctggtggcgctgatccccgccgcgctggcggcgttaacgatgctggccgtgacattggcgcgcggcgcgtttcgccgctcgaagatcggccgcgccccccgccgctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z