BBa_K823002 1 BBa_K823002 P_lepA 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 PlepA is the promoter of the PlepA gene of Bacillus subtilis. It is a constitutive promoter and does not contain a ribosome binding site. false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft BBa_K1364017 1 BBa_K1364017 Promotor PlepA + RBS spoVG 2014-10-01T11:00:00Z 2015-06-08T09:09:06Z http://parts.igem.org/Part:BBa_K823002 http://parts.igem.org/Part:BBa_K143021 PlepA is a constitutive promotor in Bacillus subtilis (BBa_K823002) coupled with a RBS spoVG (BBa_K143021). To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency. false false _1740_ 4206 21465 9 In stock false The sequence has been verified by sequencing false Jourdan Camille component2392216 1 BBa_K143021 component2392214 1 BBa_K823002 annotation2392216 1 BBa_K143021 range2392216 1 166 177 annotation2392214 1 BBa_K823002 range2392214 1 1 157 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K143021_sequence 1 aaaggtggtgaa BBa_K1364017_sequence 1 agtcaatgtatgaatggatacgggatatgaatcaataagtacgtgaaagagaaaagcaacccagatatgatagggaacttttctctttcttgttttacattgaatctttacaatcctattgatataatctaagctagtgtattttgcgtttaatagttactagagaaaggtggtgaa BBa_K823002_sequence 1 agtcaatgtatgaatggatacgggatatgaatcaataagtacgtgaaagagaaaagcaacccagatatgatagggaacttttctctttcttgttttacattgaatctttacaatcctattgatataatctaagctagtgtattttgcgtttaatagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z