BBa_K1366003 1 BBa_K1366003 lpp 50 bp homology 2014-10-09T11:00:00Z 2015-05-08T01:10:07Z This sequence comes from upstream the region of lpp gen lpp 50 bp homology false false _1743_ 0 16722 9 Not in stock false It begins -60 from the beginning of lpp gen false Eduardo Cepeda Ca??edo BBa_K1366003_sequence 1 ctttgtgtaatacttgtaacgctacatggagattaactcaatctagaggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z