BBa_K1366004 1 BBa_K1366004 lpp 50 bp homology (2) 2014-10-09T11:00:00Z 2015-05-08T01:10:07Z This sequence comes from downstream the region of lpp gen lpp 50 bp homology (2) false false _1743_ 0 16722 9 Not in stock false It begins 10 bp after the lpp gen sequence false Eduardo Cepeda Ca??edo BBa_K1366004_sequence 1 cacattgtgcgccattttttttgtctgccgtttaccgctactgcgtcacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z