BBa_K1366005 1 BBa_K1366005 Amp R promoter 2014-10-09T11:00:00Z 2015-05-08T01:10:07Z ttcaaatatgtatccgctcatgagacaat Amp R constitutive promoter false false _1743_ 0 16722 9 No part sequence false Amp R constitutive promoter false Eduardo Cepeda Ca??edo igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z