BBa_K137031 1 BBa_K137031 constitutive promoter with (C)10 between -10 and -35 elements 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z This part was PCR amplified from two synthesized primers that bound to each other. constitutive promoter with (C)10 between -10 and -35 elements false false _187_ 0 3112 9 It's complicated false With 10 C repeats between the -10 and -35 elements, the distance between the two elements is optimal for the sigma factor to bind to the promoter. Thus, the promoter should be in the 'on' state. false Allen Lin annotation1967768 1 -10 range1967768 1 50 55 annotation1967769 1 C repeat range1967769 1 27 36 BBa_K137031_sequence 1 ttaatttttattaatatatgtaaaatccccccccccgaaagcttaagaatataattgtaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z