BBa_K137010 1 fimE IRL fimE IRL 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat left recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963844 1 IRL out range1963844 1 19 35 annotation1963843 1 IRL in range1963843 1 1 17 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K137008 1 IRR fimE IRR 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat right recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963842 1 IRR in range1963842 1 19 35 annotation1963841 1 IRR out range1963841 1 1 17 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K137059 1 BBa_K137059 GFP fimE switch with 350 bp tetR promoter 2008-07-30T11:00:00Z 2015-05-08T01:10:09Z Previously constructed Biobrick parts. A promoter facing upstream is flanked by two FimE binding sites. GFP is downstream to this fimE switch. Active FimE will flip the promoter such that GFP is expresssed. false false _187_ 0 3112 9 It's complicated false None. false Allen Lin component1969308 1 BBa_K137010 component1969318 1 BBa_B0010 component1969310 1 BBa_K137048 component1969313 1 BBa_K137008 component1969320 1 BBa_B0012 component1969317 1 BBa_E0040 component1969315 1 BBa_B0034 annotation1969308 1 BBa_K137010 range1969308 1 1 35 annotation1969317 1 BBa_E0040 range1969317 1 463 1182 annotation1969310 1 BBa_K137048 range1969310 1 44 393 annotation1969315 1 BBa_B0034 range1969315 1 445 456 annotation1969320 1 BBa_B0012 range1969320 1 1279 1319 annotation1969318 1 BBa_B0010 range1969318 1 1191 1270 annotation1969313 1 BBa_K137008 range1969313 1 402 436 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K137048 1 BBa_K137048 350 bp inverted tetR promoter 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z Primers were synthesized to bind to part Q04400, and then a PCR reaction was run. Inverted tetR promoter with noncoding, spacer DNA upstream of it to make the total length 350 bp. false false _187_ 0 3112 9 It's complicated false This part is in a series of inverted tetR promoters that have total lengths of 150, 250, 350, 450, 650, and 850 bp. We chose the region upstream of tetR in part Q04400 to be the noncoding DNA segment. This noncoding segment consists of the 3' end of tetR and B0015. None of the parts in this series was long enough to include the start codon of tetR, so a functional tetR protein should not be transcribed. false Allen Lin annotation1968021 1 tetR promoter range1968021 1 1 54 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K137048_sequence 1 gtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtg BBa_K137010_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatt BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K137008_sequence 1 aagatgaaacatttggggccaaactgtccatatta BBa_B0034_sequence 1 aaagaggagaaa BBa_K137059_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatttactagaggtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgtactagagaagatgaaacatttggggccaaactgtccatattatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z