BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K137008 1 IRR fimE IRR 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat right recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963842 1 IRR in range1963842 1 19 35 annotation1963841 1 IRR out range1963841 1 1 17 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K137061 1 BBa_K137061 GFP fimE switch with 650 bp tetR promoter 2008-07-30T11:00:00Z 2015-05-08T01:10:09Z Previously constructed Biobrick parts. A promoter facing upstream is flanked by two FimE binding sites. GFP is downstream to this fimE switch. Active FimE will flip the promoter such that GFP is expresssed. false false _187_ 0 3112 9 It's complicated false None. false Allen Lin component1969344 1 BBa_K137010 component1969346 1 BBa_K137050 component1969354 1 BBa_B0010 component1969351 1 BBa_B0034 component1969349 1 BBa_K137008 component1969356 1 BBa_B0012 component1969353 1 BBa_E0040 annotation1969349 1 BBa_K137008 range1969349 1 702 736 annotation1969346 1 BBa_K137050 range1969346 1 44 693 annotation1969354 1 BBa_B0010 range1969354 1 1491 1570 annotation1969356 1 BBa_B0012 range1969356 1 1579 1619 annotation1969351 1 BBa_B0034 range1969351 1 745 756 annotation1969353 1 BBa_E0040 range1969353 1 763 1482 annotation1969344 1 BBa_K137010 range1969344 1 1 35 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K137050 1 BBa_K137050 650 bp inverted tetR promoter 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z Primers were synthesized to bind to part Q04400, and then a PCR reaction was run. Inverted tetR promoter with noncoding, spacer DNA upstream of it to make the total length 650 bp. false false _187_ 0 3112 9 It's complicated false This part is in a series of inverted tetR promoters that have total lengths of 150, 250, 350, 450, 650, and 850 bp. We chose the region upstream of tetR in part Q04400 to be the noncoding DNA segment. This noncoding segment consists of the 3' end of tetR and B0015. None of the parts in this series was long enough to include the start codon of tetR, so a functional tetR protein should not be transcribed. false Allen Lin annotation1968023 1 tetR promoter range1968023 1 1 54 BBa_K137010 1 fimE IRL fimE IRL 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat left recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963843 1 IRL in range1963843 1 1 17 annotation1963844 1 IRL out range1963844 1 19 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K137010_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatt BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K137008_sequence 1 aagatgaaacatttggggccaaactgtccatatta BBa_B0034_sequence 1 aaagaggagaaa BBa_K137061_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatttactagaggtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgatcaaataattcgatagcttgtcgtaataatggcggcatactatcagtagtaggtgtttccctttcttctttagcgacttgatgctcttgatcttccaatacgcaacctaaagtaaaatgccccacagcgctgagtgcatataatgcattctctagtgaaaaaccttgttggcataaaaaggctaattgattttcgagagtttcatactgtttttctgtaggccgtgtacctaaatgtacttttgctccatcgcgatgacttagtaaagcacatctaaaacttttagcgttattacgtaatactagagaagatgaaacatttggggccaaactgtccatattatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K137050_sequence 1 gtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgatcaaataattcgatagcttgtcgtaataatggcggcatactatcagtagtaggtgtttccctttcttctttagcgacttgatgctcttgatcttccaatacgcaacctaaagtaaaatgccccacagcgctgagtgcatataatgcattctctagtgaaaaaccttgttggcataaaaaggctaattgattttcgagagtttcatactgtttttctgtaggccgtgtacctaaatgtacttttgctccatcgcgatgacttagtaaagcacatctaaaacttttagcgttattacgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z