BBa_K1378031 1 BBa_K1378031 Holin from lambda phage 2014-09-27T11:00:00Z 2015-05-08T01:10:12Z We get this part by de novo synthesis. Holin is a 105-amino-acid-residue cytoplasmic membrane protein with three transmembrane domains, naturally expressed by double-stranded lambada phage. Holin will oligomerize and form a hole on the inner membrane of host bacteria at a certain time at an allele-specific time. And then the formation of hole will help Endolysin, a kind of lysozyme, come out from cytoplasm to periplasm to degrade peptidoglycan and inhibit the respiration by eliminating proton gradient. false false _1755_ 0 21239 9 In stock false Because Holin will do harm to bacteria, we need to carefully inhibi it's expression if we put the gene of Holin into the bacteria. false Wu Jie annotation2427077 1 holin range2427077 1 1 318 BBa_K1378031_sequence 1 atgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z