BBa_K1379000 1 BBa_K1379000 P_celA 2014-09-21T11:00:00Z 2015-05-08T01:10:12Z This promoter is found in genomic sequence of Streptococcus pneumoniae NCTC7465 strain A sigmaX-dependent promoter initiating the transcription of competence CelA protein false false _1756_ 0 21235 9 In stock false N/A false Ng Siu Wang Edward, Jason Jang, Joo Min Jung annotation2386512 1 Com-Box range2386512 1 74 81 annotation2386511 1 PcelA range2386511 1 1 100 BBa_K1379000_sequence 1 ttgaccaaggaagactattttgcaaataaataagcagttgaaaagaaatttttcgactgttttttcttcctcttacgaataatctaagagaggagaaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z