BBa_K1381002 1 yenbox_J23 yenbox_J23101 2014-10-01T11:00:00Z 2015-05-08T01:10:13Z The sequence of the yenbox was taken from Y. enterocoliticas genome and the promoter sequence of the promoter was taken from the Anderson promoter J23101 (BBa_J23101). yenbox_J23101 consists of the Anderson promoter J23101 fused togheter upstreams of a luxbox homoloug, called the yenbox. When interaction between the yenbox and the activator YenR occur, the base level of expression of the promoter should be induced. false false _1758_ 0 17260 9 In stock false The source of the yenbox in this part is Y. enterocolitica and the source of the promoter is from the BioBrick BBa_J23101. false Stephanie Herman, Gunta Celma, Megha Biradar, Christoffer Andersson and Martin Friberg annotation2391917 1 yenbox range2391917 1 1 45 annotation2391918 1 J23101 range2391918 1 46 80 BBa_K1381002_sequence 1 aaacctagaccaaagtatagtttagataactagacctaaggctagtttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z