BBa_K1393000 1 BBa_K1393000 OprF(Val188)+GS linker+CBP 2014-10-01T11:00:00Z 2015-07-22T02:47:15Z The OprF gene is from Pseudomonas aeruginosa. The OprF is a major outer membrane protein of Pseudomonas aeruginosa. This protein functions as a nonspecific porin to allow the passage of small hydrophilic molecules, plays a structural role in maintaining cell shape and outer membrane integrity, and is required for growth under low osmolality.The structure of OprF has been proposed to consist of three domains, the N-terminal forming h-barrel structure, a loop or hinge region, and the C-terminal associated with peptidoglycan. false false _1770_ 4206 20256 9 It's complicated false Based on the predicted secondary structure and information found in the literature, we chose Val(188）as potential fusion sites for displaying CBP.CBP is the abbreviation of copper binding peptide made up of seven amino acid.In order to reduce the effect on the CBP activity，we added (G4S) linker between OprF and CBP . false Jiajun Tan annotation2392394 1 OprF to Val188 range2392394 1 1 564 annotation2392395 1 CBP range2392395 1 579 600 BBa_K1393000_sequence 1 atgaaactgaagaacaccttaggcgttgtcatcggctcgctggttgccgcttcggcaatgaacgcctttgcccagggccagaactcggtagagatcgaagccttcggcaagcgctacttcaccgacagcgttcgcaacatgaagaacgcggacctgtacggcggctcgatcggttacttcctgaccgacgacgtcgagctggcgctgtcctacggtgagtaccatgacgttcgtggcacctacgaaaccggcaacaagaaggtccacggcaacctgacctccctggacgccatctaccacttcggtaccccgggcgtaggtctgcgtccgtacgtgtcggctggtctggctcaccagaacatcaccaacatcaacagcgacagccaaggccgtcagcagatgaccatggccaacatcggcgctggtctgaagtactacttcaccgagaacttcttcgccaaggccagcctcgacggccagtacggtctggagaagcgtgacaacggtcaccagggcgagtggatggctggcctgggcgtcggcttcaacttcggtggttcgaaaggtggcggaggttcatccccgcatcatggcggctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z