BBa_K1399008 1 BBa_K1399008 GFP (mut3b) with DAS-ssrA degradation tag 2014-09-18T11:00:00Z 2015-05-08T01:10:16Z GFP comes from part BBa_E0040, the tag sequence was obtained from part BBa_M0052. GFP (mut3b) (see part BBa_E0040) with added DAS-ssrA degradation tag (see part BBa_M0052). The tag increases GFP turn-over rate, thus providing better temporal resolution of green fluorescence. In the same time, maximal fluorescence amplitudes will be lower as newly formed protein is degraded as soon as it is formed. SsrA tags encode peptide sequence that is recognized by ClpA and ClpX unfoldases and ClpX mediator SspB.[1] ClpA and ClpX then form a proteosome-like complex with ClpP protease and the protein is degraded.[1] The final three residues of the tag determines the strength of interaction with ClpX and thus the final protein degradation rate.[2] The DAS tag encodes peptide sequence AANDENYADAS is reported to have low affinity to ClpX thus its mediated degradation very much depends on the concentration of SspB (ClpX mediator).[1] However, be aware that exact protein degradation rate is influenced by multiple other factors: ClpXP and ClpAP protease concentrations, protein stability, Km of binding to the protease, temperature [3]. ===References=== [1] Flynn, J. M. et al. Overlapping recognition determinants within the ssrA degradation tag allow modulation of proteolysis. Proc. Natl. Acad. Sci. U. S. A. 98, 10584???9 (2001). [2] Andersen, J. B. et al. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl. Environ. Microbiol. 64, 2240???6 (1998). [3] Purcell, O., Grierson, C. S., Bernardo, M. Di & Savery, N. J. Temperature dependence of ssrA-tag mediated protein degradation. J. Biol. Eng. 6, 10 (2012). false false _1777_ 0 22477 9 In stock true The tag was attached to GFP using PCR and MABEL (mutagenesis with blunt-end ligation), thus avoiding introduction of additional residues and restriction site. Different parts of the tag are recognized by different proteins, for example, the final 3 residues (DAS in this case) are recognized by ClpX, whereas first 4 residues of the tag are required for efficient SspB binding.[1] Thus modifications of these critical residues alter the efficacy with what different proteases bind to it. false Anna Stikane annotation2383928 1 start range2383928 1 1 3 annotation2383932 1 stop range2383932 1 751 753 annotation2383931 1 stop range2383931 1 748 750 annotation2383929 1 GFP (mut3b) range2383929 1 3 714 annotation2383930 1 DAS-ssrA tag range2383930 1 715 747 BBa_K1399008_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagctgcaaacgacgaaaactacgctgacgcttcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z