BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 BBa_K1401009 1 BBa_K1401009 Transcriptional Unit with pTet-pBad tandem promoter 2014-10-08T11:00:00Z 2015-05-08T01:10:16Z Tandem Promoter Reference Paper This transcriptional unit contains the following: pBad-pTet - BCD2 - RFP - B0015. The transcriptional unit is induced by arabinose and atc. This is a Level 1 MoClo part with flanking sites A on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. This transcriptional unit has Kanamycin resistance. false false _1779_ 0 22443 9 It's complicated false This part was created using the MoClo assembly method. The tandem promoters were created by combining two promoters together without any additional sequence in between. false Kathleen Lewis component2407918 1 BBa_R0040 component2407937 1 BBa_B0015 component2407927 1 BBa_K1114107 component2407923 1 BBa_I13453 component2407930 1 BBa_E1010 annotation2407918 1 BBa_R0040 range2407918 1 1 54 annotation2407930 1 BBa_E1010 range2407930 1 299 1004 annotation2407923 1 BBa_I13453 range2407923 1 63 192 annotation2407937 1 BBa_B0015 range2407937 1 1013 1141 annotation2407927 1 BBa_K1114107 range2407927 1 201 292 BBa_K1114107 1 BBa_K1114107 Bicistronic Design RBS 2, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z This part was cloned off a BCD template from Sonya Iverson. Sonya Iverson based her designs for her BCD2 part off of a paper published by <a href= ???http://www.nature.com/nmeth/journal/v10/n4/full/nmeth.2404.html????>Mutalik, et al.</a> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 In stock false This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361727 1 MoClo Fusion Site B range2361727 1 1 4 annotation2361728 1 MoClo Fusion Site C range2361728 1 89 92 annotation2361724 1 BCD2 range2361724 1 5 88 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1401009_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagtactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgtactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K1114107_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z