BBa_K1405002 1 ModA ModA 2014-10-01T11:00:00Z 2015-05-08T01:10:17Z It is from E.coil. ModA is a subunit of ModABC(ATP-binding cassette) trabsporter protein which can bind molybdenum. Molybdenum is an essential component of a large number of enzymes, where it is present in the form of two types of cofactor: the iron???molybdenum cofactor, in nitrogenase, and the molybdopterin cofactors in all the other known molybdoenzymes. Molybdenum is a relatively abundant element in the earth???s crust, in two main chemical forms, MoS2,and MoO2-. Only Mo(VI)in the form of molybdate is readily soluble and stable in aqueous solutions, and it is thus the only relevant source of molybdenum for biological systems. We want to use ModA to bind molubdenum then carry it to the plants. false false _1783_ 0 20328 9 In stock true We change several sites of the gene to evaluate the binding efficiency. false Xuan Wang,Yuelong Hou annotation2424692 1 ModA range2424692 1 1 774 BBa_K1405002_sequence 1 atggctcgtaaatggttgaacttgtttgccggggcggcactctctttcgctgttgctggcaatgcactggcagatgaagggaaaatcacggtgttcgccgccgcatcactgactaacgcaatgcaggacattgctacgcagtttaaaaaagagaaaggcgtggatgtggtttcttctttcgcttcgtcatctactctcgcccgtcagattgaagcgggtgcgcctgcggatctgtttatttctgccgatcagaaatggatggattatgcggttgataaaaaagcgatcgatacagctacgcgtcagacactgctcggcaatagcctggtcgttgtagcaccgaaagccagcgtgcagaaagatttcaccatcgacagcaaaaccaactggacttcactgctgaatggcggtcgcctggcggttggcgatccggaacatgttcccgctggcatttatgcaaaagaagcactgcaaaaactgggcgcatgggatacgctctctccgaaactggccccagcggaagatgttcgtggggcgctggcgctggtcgaacgtaacgaagcgcctctgggcattgtctacggttctgacgcagttgccagcaaaggggtaaaagtggttgccaccttcccggaagattcacataaaaaagtggaatatccggttgctgttgtggaagggcataacaatgcgacagtgaaagcattttatgattatctgaagggaccgcaggcagcggaaatctttaaacgttacggatttacaatcaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z