BBa_K1415001 1 BBa_K1415001 PBAN (Bombyx mori) 2014-10-01T11:00:00Z 2015-05-08T01:10:18Z Artificial synthesis from known amino acid sequence. n our project, we will biologically synthesize PBAN with our E.coli. We store the PBAN inside a trapping device (check this out at our Device page). In the device, there will be appropriate lighting and nutrient sources that will attract insects.Once an insect is attracted into our device and ingests the nutrient sources we provide, it will also inevitably come in contact with our PBAN, which is evenly mixed with the nutrient sources. As the PBAN works its magic and activates the pheromone synthesis of the attracted insect, more of this species of insect???s counterparts will be attracted and later captured.Owing to the first feature mentioned above, PBANs are species-specific, which means that it doesn't matter if other kind of insect fly into our device and eat PBANs, because the insects we don't want to catch will not be stimulated by PBANs to produce pheromone; our PBANs are only for what we want to catch, we are sure that our method won't affect other kinds of insects. false false _1793_ 0 22512 9 In stock false None false HO, TSUNG YU annotation2391945 1 PBAN (Bombyx mori) range2391945 1 1 109 BBa_K1415001_sequence 1 atgctgtccgaggatatgccggcgacgccagcagaccaggagatgtatcaaccagatccggaagaaatggagtctcgtacccgttacttcagcccgcgcctgtaataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z