BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1415201 1 BBa_K1415201 Pcons+B0034+PBAN(Bombyx mori)+B0034+BFP+J61048 2014-10-04T11:00:00Z 2015-05-08T01:10:19Z Assemble We use this part as reporter gene, it can check whether our PBAN works and quantify its expression. false false _1793_ 0 22512 9 It's complicated false No false HO, TSUNG YU component2394017 1 BBa_K1415001 component2394021 1 BBa_K592100 component2394015 1 BBa_B0034 component2394019 1 BBa_B0034 component2394013 1 BBa_J23101 component2394022 1 BBa_J61048 annotation2394017 1 BBa_K1415001 range2394017 1 62 170 annotation2394013 1 BBa_J23101 range2394013 1 1 35 annotation2394015 1 BBa_B0034 range2394015 1 44 55 annotation2394019 1 BBa_B0034 range2394019 1 179 190 annotation2394021 1 BBa_K592100 range2394021 1 197 901 annotation2394022 1 BBa_J61048 range2394022 1 910 1022 BBa_J61048 1 BBa_J61048 [rnpB-T1] Terminator 2007-02-20T12:00:00Z 2015-08-31T02:03:00Z bob bob false false _95_ 0 483 95 In stock false bob true John Anderson BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K592100 1 BFP Blue Fluorescent Protein (mTagBFP) 2011-09-19T11:00:00Z 2016-01-25T04:45:27Z Subach, O. M., I. S. Gundorov, et al. (2008). "Conversion of red fluorescent protein into a bright blue probe." Chem Biol 15(10): 1116-24. Released HQ 2013 This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a monomeric protein with a narrow fluorescence emission spectrum with a maximum at 456 nm. It has a tyrosine-based chromophore, giving it substantially higher brightness, faster chromophore maturation and higher pH stability than blue fluorescent proteins with a histidine in the chromophore. Subach et. al. started with a red fluorescent protein (TagRed) and converted it to a bright blue monomeric protein. See the article listed in source. The sequence has been codon optimized for expression in E coli by DNA 2.0. false false _763_ 4206 10137 9 In stock true The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2135490 1 mTagBFP range2135490 1 1 699 BBa_K1415001 1 BBa_K1415001 PBAN (Bombyx mori) 2014-10-01T11:00:00Z 2015-05-08T01:10:18Z Artificial synthesis from known amino acid sequence. n our project, we will biologically synthesize PBAN with our E.coli. We store the PBAN inside a trapping device (check this out at our Device page). In the device, there will be appropriate lighting and nutrient sources that will attract insects.Once an insect is attracted into our device and ingests the nutrient sources we provide, it will also inevitably come in contact with our PBAN, which is evenly mixed with the nutrient sources. As the PBAN works its magic and activates the pheromone synthesis of the attracted insect, more of this species of insect???s counterparts will be attracted and later captured.Owing to the first feature mentioned above, PBANs are species-specific, which means that it doesn't matter if other kind of insect fly into our device and eat PBANs, because the insects we don't want to catch will not be stimulated by PBANs to produce pheromone; our PBANs are only for what we want to catch, we are sure that our method won't affect other kinds of insects. false false _1793_ 0 22512 9 In stock false None false HO, TSUNG YU annotation2391945 1 PBAN (Bombyx mori) range2391945 1 1 109 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1415201_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgctgtccgaggatatgccggcgacgccagcagaccaggagatgtatcaaccagatccggaagaaatggagtctcgtacccgttacttcagcccgcgcctgtaataattactagagaaagaggagaaatactagatgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataatactagagccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa BBa_J61048_sequence 1 ccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa BBa_K1415001_sequence 1 atgctgtccgaggatatgccggcgacgccagcagaccaggagatgtatcaaccagatccggaagaaatggagtctcgtacccgttacttcagcccgcgcctgtaataat BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K592100_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z