BBa_K1415004 1 BBa_K1415004 PBAN (Lymantria dispar) 2014-10-02T11:00:00Z 2015-05-08T01:10:18Z Artificial synthesis Gypsy Moth (Lymantria dispar) Spread: It has a range which covers Europe, Africa, and North America. Characteristics:Gypsy moth caterpillars change appearance as they grow. Young caterpillars are black or brown and about ?? inch (.6 cm) in length. As they grow, bumps develop along their backs along with coarse, black hairs. Each of the 11 sections of a developed caterpillar will have two coloured spots, the first five pairs, blue, and the last six, red. Mature caterpillars can be as long as 2 ?? inches (6.35 cm). Damage: It is classified as a pest, and its larvae consume the leaves of over 500 species of trees, shrubs and plants. The gypsy moth is one of the most destructive pests of hardwood trees in the eastern United States.he gypsy moth was considered a nuisance just ten years after their release. It included an account of all the trees being defoliated, caterpillars covering houses and sidewalks and that the caterpillars would rain down upon residents. The first outbreak occurred in 1889. An eradication program was begun in 1890. Control: Tanglefoot Pest Barrier or Sticky Tree Bands can be placed around tree trunks to help curtail the caterpillars movement into and out of the tree canopy. Apply Bacillus thuringiensis, var. kurstaki or Monterey Garden Insect Spray (Spinosad) to the leaves of trees to kill gypsy moth caterpillars. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU annotation2392676 1 PBAN (Lymantria dispar) range2392676 1 1 109 BBa_J61048 1 BBa_J61048 [rnpB-T1] Terminator 2007-02-20T12:00:00Z 2015-08-31T02:03:00Z bob bob false false _95_ 0 483 95 In stock false bob true John Anderson BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1415204 1 BBa_K1415204 Pcons+B0034+PBAN(Lymantria dispar)+B0034+BFP+J61048 2014-10-04T11:00:00Z 2015-05-08T01:10:20Z Assemble We use this part as reporter gene, it can check whether our PBAN works and quantify its expression. false false _1793_ 0 22512 9 It's complicated false No false HO, TSUNG YU component2394045 1 BBa_B0034 component2394049 1 BBa_B0034 component2394052 1 BBa_J61048 component2394043 1 BBa_J23101 component2394051 1 BBa_K592100 component2394047 1 BBa_K1415004 annotation2394043 1 BBa_J23101 range2394043 1 1 35 annotation2394049 1 BBa_B0034 range2394049 1 179 190 annotation2394047 1 BBa_K1415004 range2394047 1 62 170 annotation2394045 1 BBa_B0034 range2394045 1 44 55 annotation2394052 1 BBa_J61048 range2394052 1 910 1022 annotation2394051 1 BBa_K592100 range2394051 1 197 901 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K592100 1 BFP Blue Fluorescent Protein (mTagBFP) 2011-09-19T11:00:00Z 2016-01-25T04:45:27Z Subach, O. M., I. S. Gundorov, et al. (2008). "Conversion of red fluorescent protein into a bright blue probe." Chem Biol 15(10): 1116-24. Released HQ 2013 This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a monomeric protein with a narrow fluorescence emission spectrum with a maximum at 456 nm. It has a tyrosine-based chromophore, giving it substantially higher brightness, faster chromophore maturation and higher pH stability than blue fluorescent proteins with a histidine in the chromophore. Subach et. al. started with a red fluorescent protein (TagRed) and converted it to a bright blue monomeric protein. See the article listed in source. The sequence has been codon optimized for expression in E coli by DNA 2.0. false false _763_ 4206 10137 9 In stock true The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2135490 1 mTagBFP range2135490 1 1 699 BBa_B0034_sequence 1 aaagaggagaaa BBa_J61048_sequence 1 ccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K592100_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa BBa_K1415204_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgctggcggacgatatgccggccacgatggcggaccaggaagtgtatcgcccagagccggaacaaattgattctcgtaataaatactttagcccgcgcctgtaataattactagagaaagaggagaaatactagatgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataatactagagccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa BBa_K1415004_sequence 1 atgctggcggacgatatgccggccacgatggcggaccaggaagtgtatcgcccagagccggaacaaattgattctcgtaataaatactttagcccgcgcctgtaataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z