BBa_K1424000 1 BBa_K1424000 Prefix homologous recombination for Synechocystis ("Left flank") 2014-09-24T11:00:00Z 2015-05-08T01:10:23Z This part comes from genomic sequence of Synechocystis sp. PCC 6803 This is a prefix region of DNA for homologous recombination into a neutral site within the genome of Synechocystis sp. PCC 6803. Kunert, A., Hagemann, M. & Erdmann, N. (2000) Construction of promoter probe vectors of Synechocystis sp. PCC 6803 using the light-emitting reporter systems Gfp and LuxAB. J. Microbiol. Methods. 41, 185-194 Angermayr, S. A., Paszota, M. & Hellingwerf, K. J. (2012) Engineering a cyanobacterial cell factory for production of lactic acid. Appl. Environ. Microbiol. 78, 7098-7106 false false _1802_ 0 20667 9 In stock false n/a false Jacob Lamb annotation2400751 1 Synechocystis prefix homologous integration region range2400751 1 1 556 BBa_K1424000_sequence 1 cctttgacaacaatgtggcctggaataacctgggggatttgtccaccaccacccaacgggcctacacttcggctattagcacagacacagtgcagagtgtttatggcgttaatctggaaaaaaacgataacattcccattgtttttgcgtggcccatttttcccaccacccttaatcccacagattttcaggtaatgcttaacacgggggaaattgtcaccccggtgatcgcctctttgattcccaacagtgaatacaacgaacggcaaacggtagtaattacgggcaattttggtaatcgtttaaccccaggcacggagggagcgatttatcccgtttccgtaggcacagtgttggacagtactcctttggaaatggtgggacccaacggcccggtcagtgcggtgggtattaccattgatagtctcaacccctacgtggccggcaatggtcccaaaattgtcgccgctaagttagaccgcttcagtgacctgggggaaggggctcccctctggttagccaccaatcaaaataacagtggcggggatttatatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z