BBa_K1427001 1 BBa_K1427001 merRNA, c-di-GMP aptamer with promoter and terminators 2014-10-16T11:00:00Z 2015-05-08T01:10:23Z Bdellovibrio bacteriovorus This part contains BBa_K1427001 under the transcriptional control of a constitutive T7 promoter. Additionally, terminators developed by the Voigt Lab flank the merRNA sequence. There is an upstream ECK120033737 terminator which stops read-through by other genes. Downstream of the merRNA sequence, bidirectional termination is ensured with ECK120029600 and ECK120033736. It is likely these are redundant, as the poly-U tail of the merRNA suggests that is contains an intrinsic terminator. false false _1805_ 0 23756 9 In stock false The T7 promoter initiates transcription 2 nucleotides (GG) upstream of the actual merRNA sequence. Predictive RNA folding programs did not report any change in secondary structure with this small 5' addition. false Connor McBrine annotation2427466 1 T7 promoter range2427466 1 58 76 annotation2427491 1 ECK120029600 range2427491 1 522 611 annotation2427463 1 merRNA range2427463 1 77 521 annotation2427494 1 ECK120033736 range2427494 1 612 664 annotation2427464 1 ECK120033737 range2427464 1 1 57 BBa_K1427001_sequence 1 ggaaacacagaaaaaagcccgcacctgacagtgcgggctttttttttcgaccaaaggtaatacgactcactataggcaaggctcgggagacttacctcgggtaagtgaacgctagtagggccaagcgaaggaggacacggatgagaacacatgaacatcacgatgacgaactgaagtgaagatgcgtcaccaggattactacaaagaggttgggttcatgcctctctaaagaagaatggactggttggatctgatgaataactcataaggaggttcctagggttatactcgttaggatatagatccttcctttgcctcaaggcaaaccgtcggaaacggcgggacgcaaagctaaaggggtgtcggtgcaaagccacgccagccagctgccaaaggtcatgagtcacctgaggaatcagaggtgtgcatatggaaggaacaaatacatacaaggattggtttcattccccttagctagcgagttatcactgacgattcctcgctagcactttttttggcgattcagccaaaaaacttaagaccgccggtcttgtccactaccttgcagtaatgcggtggacaggatcggcggttttcttttctcttctcaagcgcaataaaaaagcccccggaaggtgatcttccgggggctttctcatgcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z