BBa_K143011 1 PgsiB Promoter gsiB for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>2</cite><cite>3</cite>. This sequence was then synthesised by Geneart. Promoter gsiB is a sigma factor B dependent promoter found in ''B.subtilis''. In ''B.subtilis'' endogenous sigma factor B is activated under mild stress. These mild stress conditions can be generally split into nutrient stress response and physical stress response. Nutrient stress response is triggered by low levels of ATP and GTP and physical stress response is triggered by exposure to blue light, salt, heat, acid or ethanol<cite>1</cite>. The promoter gsiB has been used previously as a read out for the activation of sigma factor B <cite>2</cite>. The context with which we used the promoter gsiB, was to take blue light as an input and give '''Polymerase Per Second'''(PoPS) as an output. To do this the other potential inputs need to be carefully controlled so that only blue light activated the sigma B and gives a PoPS output. In order to get sufficient sigma B activation by blue light the light receptor YtvA, part...., needs to be over expressed in ''B.subtilis'' <cite>3</cite>. false false _199_ 0 2090 9 Not in stock false Biobrick standard was applied to the promoter gsiB sequence. false James Chappell annotation1975702 1 Sigma B -35 range1975702 1 6 11 annotation1975703 1 Sigma B -10 range1975703 1 25 30 BBa_K143011_sequence 1 tgtttgtttaaaagaattgtgagcgggaatacaacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z