BBa_K1433002 1 BBa_K1433002 attL-J23110-attR 2014-09-27T11:00:00Z 2015-05-08T01:10:25Z this parts are construct from BBa_J23110 by adding attL/attR sites using PCR Bxb1 gp35 is a serine integrase and Bxb1 gp47 is an excisionase in Mycobacterium phage Bxb1. This part is composed of 2 elements. 1. Promoter (reverse): BBa_J23110, a middle-ground Bacterial constitutive promoter. 2. attL and attR sites: Recognition site for Bxb1 gp35, Mycobacterium Phage Bxb1 DNA integrase. This part promotes transcription and translation upstream gene, and when treat with heterologous of Bxb1 gp35 and gp47, downstream gene will express. false false _1811_ 0 20519 9 In stock false No false Hanqing Liu annotation2412265 1 attL range2412265 1 1 50 annotation2412267 1 attR range2412267 1 86 138 annotation2412266 1 J23110 range2412266 1 51 85 BBa_K1433002_sequence 1 tcggccggcttgtcgacgacggcggtctcagtggtgtacggtacaaacccgctagcattgtacctaggactgagctagccgtaaagcccggatgatcctgacgacggagaccgcggtggttgaccagacaaaccacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z