BBa_K1441000 1 BBa_K1441000 Mambalgin-1 (Analgesic) 2014-09-21T11:00:00Z 2015-05-08T01:10:26Z Dendroaspis polylepis (African Black Mamba Snake) Mambalgin (~200bp) exhibits analgesic properties that are similar in nature to morphine but has been shown not to carry the same dependency and withdrawal issues. The protein is naturally found in the African Black Mamba snake venom. Due to its reptilian origin the Mambalgin must be expressed in a Eukaryotic cell so that the necessary post-translational modifications can take place. The Mambalgin insert has been optimized for the pGAPzα vector system which is compatible with the yeast Pichia pastoris. false false _1819_ 0 23093 9 In stock true Completely optimized for expression in the pGAPzα vector system including custom promoter sequence and alpha secretion factor for easy extraction of the protein. false Julia Dave, BBa_K1441000_sequence 1 aattcactgaaatgttaccaacatggtaaagttgtgacttgtcatcgagatatgaagttttgctatcataacactggcatgccttttcgaaatctcaagctcatcctacagggatgttcttcttcgtgcagtgaaacagaaaacaataagtgttgctcaacagacagatgcaacaaaactgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z