BBa_K1442029 1 BBa_K1442029 T7 Promoter Soler Bistue 2014-09-03T11:00:00Z 2015-05-08T01:10:26Z Sequence obtained from Soler Bistu??. Antimicrob. Agents Chemother. 2007, 51:1918 The T7 promoter is used to initiate transcription when placed at the 5' end of a DNA sequence false false _1820_ 0 23056 9 Not in stock false 3 Gs at the end are essential for T7 RNAP false Caroline de Cock BBa_K1442029_sequence 1 gcgaaattaatacgactcactataggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z