BBa_K1443004 1 BBa_K1443004 RFP Binding Reverse Primer for Backbone Amplification 2014-10-08T11:00:00Z 2015-05-08T01:10:27Z The RFP coding sequence. With this primer and its forward counterpart you can amplify backbones that have RFP as the insert with PCR. The reverse primer binds to the beginning of the RFP coding sequence. These primers don't have palindromic sites. false false _1821_ 0 20708 9 Not in stock false None. false Lassi Vapaakallio BBa_K1443004_sequence 1 gctgcattaatgaatcggcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z