BBa_K1453006 1 BBa_K1453006 TAL USB-His Tag 2014-10-16T11:00:00Z 2015-05-08T01:10:29Z T1 sequence, T14 sequence This part is designed as a scaffold of the second kind of connectee, which can anchor on the membrane. In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095) false false _1831_ 0 21354 9 Not in stock false More details about TAL and Golden Gate Cloning, please view http://2012.igem.org/Team:Freiburg. false Renhe Luo annotation2425219 1 Tal USB range2425219 1 61 492 annotation2425221 1 TAA range2425221 1 511 513 annotation2425218 1 FL range2425218 1 4 60 annotation2425217 1 BBa_K1453006 range2425217 1 1 513 annotation2425216 1 ATG range2425216 1 1 3 annotation2425220 1 His Tag range2425220 1 493 510 BBa_K1453006_sequence 1 atgttaggaggtggaggtagtggtggaggtggaagtggtggaggtggtagtggtgcagctctggacacgggccagttgctgaagatcgcgaagcggggaggagtcacggcggtcgaggcggtgcacgcgtggcgcaatgcgctcacgggagcacccctcaacctgacagagacgcctgaccccggaacaggtggtggccattgcctccaatattggtggcaagcaagccctggaaaccgttcagcggctgctgccagtcctgtgccaggcacacggcttgacaccagaacaagtggtggcgatcgccagcaataacggcggtaaacaggctctggagactgtgcagcgcttgctcccagtgctgtgtcaggcccacggactccgtctcgactcacgcctgagcaggtagtggctattgcatccaacggagggggcagacccgcactggagtcaatcgtggcccagctttcgaggccggaccccgcgctggcccaccaccaccaccaccactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z