BBa_K1456009 1 BBa_K1456009 Glutathione Peroxidase (GPx) enzyme forward primer with restriction site and kozak sequence 2014-08-12T11:00:00Z 2015-05-08T01:10:31Z none we use this primer to prepare our Glutathione Peroxidase(GPx)enzyme from cDNA. false false _1834_ 0 17366 9 Not in stock false none false safa tapan BBa_K1456009_sequence 1 ggaattcggatcctctagatcgagcggccgccaccatgtgtgctgctcggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z