BBa_K1456021 1 BBa_K1456021 Glutathione Peroxidase-1 (GPx-1) enzyme forward primer-2 with restriction site and kozak sequence 2014-10-21T11:00:00Z 2015-05-08T01:10:31Z none We use this primer to prepare our Glutathione Peroxidase (GPx) enzyme from cDNA. false false _1834_ 0 20835 9 Not in stock false none false Mustafa Yılmaz BBa_K1456021_sequence 1 ggcggatcctctagagccaccatgcatcatcaccatcaccactgtgctgctcggctagcggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z