BBa_K1458005 1 BBa_K1458005 Human DsbA-L (GSTK1) gene 2014-10-14T11:00:00Z 2015-05-08T01:10:32Z Human GSTK1 on NCBI : http://www.ncbi.nlm.nih.gov/gene/373156 DsbA-L is a protein present in the ER (endoplasmic reticulum). Its main action is a Glutathione S-Transferase action on the hormone adiponectin. It has the ability to catalyze the conjugation of the reduced form of glutathione (GSH) to xenobiotic substrates for the purpose of detoxification, and it helps with binding two substrates with to s-s bonds and cellular detoxification. DsbA-L is expressed mostly in adipose tissue, and its expression level is negatively correlated with the obesity of mice and humans. DsbA-L has been shown to bind adiponectin and increase the production of the HMW species, for that it can become a novel therapeutic and industrial target. false false _1836_ 0 21457 9 Not in stock false The DsbA-L sequence had iGEM Restriction sites that had to be change according to iGEM protocol. In position 131 G was changed to A to avoid Pst1 Site. In position 446 A was changed to T to avoid Pst1 Site. In position 467 A was changed to T to avoid Pst1 Site. In position 545 C was changed to G to avoid Pst1 Site. All changes in nucleotides was done according to an amino acid chart to maintain the same amino acids at the protein sequence Level. false Shani Gal-Oz BBa_K1458005_sequence 1 atggggcccctgccgcgcaccgtggagctcttctatgacgtgctgtccccctactcctggctgggcttcgagatcctgtgccggtatcagaatatctggaacatcaacctacagttgcggcccagcctcataacagggatcatgaaagacagtggaaacaagcctccaggtctgcttccccgcaaaggactatacatggcaaatgacttaaagctcctgagacaccatctccagattcccatccacttccccaaggatttcttgtctgtgatgcttgaaaaaggaagtttgtctgccatgcgtttcctcaccgccgtgaacttggagcatccagagatgctggagaaagcgtcccgggagctgtggatgcgcgtctggtcaaggaatgaagacatcaccgagccgcagagcatcctggcggctgctgagaaggctggtatgtctgctgaacaagcccagggacttctggaaaagatcgcaacgccaaaggtgaagaaccagctcaaggagaccactgaggcagcgtgcagatacggagcctttgggctgcccatcaccgtggcccatgtggatggccaaacccacatgttatttggctctgaccggatggagctgctggcgcacctgctgggagagaagtggatgggccctatacctccagccgtgaatgccagactttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z