BBa_K1459011 1 BBa_K1459011 PmrB(N-term) 2014-10-06T11:00:00Z 2015-05-08T01:10:32Z We obtained PmrA-PmrB sequences thanks to kindness of prof. He of the University of Chicago. PmrA-PmrB two-component system is native to Salmonella enterica and in it's native state it is responsible for chemotaxis. PmrB is a transmembrane protein with iron binding peptide on it's extracellular loop. When PmrB binds iron (III) iron, it's intracellular domain gains kinase activity and phosphorylates PmrA, which subsequently binds to pmrC promoter and induces expression of chemotaxis CheZ protein. In this part iron binding tag on the extracellular loop was exchanged with a lanthanide binding tag (LBT), to allow PmrA-PmrB two-component system to respond to lanthanide ions. This part was truncated just before the iron binding tag, and PmrB(N-term) is functionally complementar to PmrB(C-term). false false _1837_ 0 20803 9 In stock false We had to truncate the sequence of PmrB just before start of iron binding tag on the extracellular loop of PmrB. false Grzegorz Ścibisz BBa_K1459011_sequence 1 atgcgttttcagcgaagagcgatgacccttcgccagcgtttaatgctgacaattggtcttattctgctggtgttccagttaatcagtaccttctggttatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z