BBa_K1459016 1 BBa_K1459016 PmrB(WT) from Salmonella enterica 2014-10-16T11:00:00Z 2015-05-08T01:10:32Z We obtained this sequence thanks to kindness of prof. He from the University of Chicago. <b>Protein name</b>:PmrB</br> <b>Other names</b>:basS, parB</br> <b>Gene name</b>:basS</br> <b>Source organism for the data</b>:Salmonella enterica subsp. enterica serovar Typhimurium str. strain LT2 / SGSC1412 / ATCC 700720</br> <b>UniProtKB signature</b>:P36557/</br> <b>Gene sequence RefSeq accession number</b>:NC_003197.1</br> <b>Protein sequence RefSeq accession number</b>:NP_463157.1</br> <b>Length</b>:356 aa</br> <b>Molecular mass</b>:40,262 Da</br> <b>Cellular localization</b>:inner plasma membrane</br> <b>Biological function</b>:Signal transduction via kinase acivities</br> PmrB(LBT) is a engineered PmrB gene, where PmrB is a sensor histidine kinase present in the inner cell membrane of many species of bacteria, including E. coli and S. enterica. With a 30 amino acid periplasmic loop, it is capa ble of binding iron (III) and aluminium ions. The binding event induces a conformational change of the protein, which leads to ATP phosphate-derived autophosphorylation of the C-terminal cytoplasmic domain, followed by transfer of the phosphate group onto th e transcriptional regulator PmrA. As part of our project, the periplasmic iron/alumin ium-binding loop of the PmrB was substituted with a synthetic sequence - a lanthanide-binding ta g, intended to bind lanthanide ions, with terbium in particular. Such a binding event would then indu ce the aforementioned conformation change and phosphorylation of the PmrA, leading it to bind to the PmrC promoter, to allow for expression of the Green Fluorescent Protein - our reporter gene.</br> If you wish to study PmrA-PmrB system more closely, we suggest familiarising yourself with following papers:</br> [1] H. Liang, X. Deng, M. Bosscher, Q. Ji, M. P. Jensen, C. He, <i>Engineering Bacterial Two-Component System PmrA/PmrB to Sense Lanthanide Ions</i>, J.Am.Chem.Soc. 2013, 135, 2037&#8722;2039</br> [2] M. Wonsten, L. Kox, S. Chamnogpol, F. Soncini, E. Groisman, <i>A Signal Transduction System that Responds to Extracellular Iron</i>,Cell, Vol. 103, 113???125, September 29, 2000</br> false false _1837_ 0 20803 9 Not in stock false We had to only amplify desired sequence. false Grzegorz &#346;cibisz BBa_K1459016_sequence 1 atgcgttttcagcgaagagcgatgacccttcgccagcgtttaacgctgacaattggtcttattctgctggtgttccagctaatcagtaccttctggttatggcatgaaagcactgagcaaatccaactgttcgagcaggcgctgcgggataatcgcaacaacgatcgccatatcatgcacgaaattcgcgaggcggtcgccagcctgatcgtccccagcgtatttatggttagcctgacgctgctggtttgctaccaggcggtacggcgtattacccgcccactcgccgaactgcaaaaagagctggaagcgcggacggcggataatctgacgccgatcgccattcacagctccacgcttgagattgagtccgtcgtctcggcgatcaatcaactggttacgcgtttgaccaccacgctcgacaatgaacgcctttttaccgccgatgtggcccatgagctacgcacgccgctgtcgggggtgcgtttgcatctggaattattgtcaaaaacccacaatgttgatgtcgcgccgcttatcgcccgtcttgaccagatgatggatagcgtctcccagcttctgcaactggcgcgcgtgggccagtcattctcttccgggaattatcaggaagtaaaactgctggaagatgtgatcctcccctcctacgatgagctgaacaccatgctggaaacgcgccagcaaactctgttgctgccggaaagcgcggcggacgtggtggtgcgcggtgacgcgacgttactgcgtatgctgctgcgaaatctggtggaaaacgcgcatcgctatagccctgaaggaacccatatcactatccacattagcgccgaccccgacgctattatggcggtcgaagacgaggggccgggtattgatgaaagcaaatgcgggaagctaagcgaagcgttcgtgcggatggacagccgttatggcggaattggcctggggctgagtatcgtcagccgcatcacccagctacatcagggacagtttttcctgcaaaaccgtacggaaagaacaggcacccgtgcctgggtgctgttgaaaaaggcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z