BBa_K1462930 1 BBa_K1462930 CTS1-1 2014-10-14T11:00:00Z 2015-05-08T01:10:36Z The targetting sequence derived from yeast can be located at cytoderm. CTS false false _1841_ 0 21372 9 Not in stock false cut short the length of the sequence. false LinZhou Li,YaRan Zhao BBa_K1462930_sequence 1 atgtcactcctttacatcattcttctattcacacaattcttactactgccaaccgatgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z