BBa_K1463501 1 rev promot J23100 promoter in reverse 2014-08-11T11:00:00Z 2015-05-08T01:10:37Z Synthesised by IDT Technologies from a given sequence. Did not come from any genomic sequence. J23100 Constitutive promoter reversed false false _1842_ 0 23036 9 Not in stock false No special design considerations other than ensuring the promoter was in reverse. false Beth Greig BBa_K1463041 1 attB Reversed PhiC31 attB site 2014-08-13T11:00:00Z 2015-05-08T01:10:37Z Sythesised by IDT Technologies from a given sequence. PhiC31 attB site false false _1842_ 0 23036 9 Not in stock false ... false Beth Greig BBa_K1463030 1 spacer Switch Nucleotide Spacer 2014-08-13T11:00:00Z 2015-05-08T01:10:36Z Synthesised by IDT Technologies from a given sequence. Sequence is not from genome. BamHI and HindIII sites contained when combined with scar sequences in switch, part BBa_K1463000. This spacer is required for the function of this larger part. false false _1842_ 0 23036 9 Not in stock false Created this part with 2 restriction sites when combined with scar sites in larger composite part. false Beth Greig BBa_K1463050 1 BBa_K1463050 PhiC31 Integrase Switch 2014-10-03T11:00:00Z 2015-05-08T01:10:37Z ... PhiC31 Integrase switch false false _1842_ 0 23036 9 In stock false ... false Beth Greig component2393542 1 BBa_K1463501 component2393545 1 BBa_K1463041 component2393540 1 BBa_K1463040 component2393541 1 BBa_K1463030 component2393543 1 BBa_B0010 annotation2393542 1 BBa_K1463501 range2393542 1 82 116 annotation2393541 1 BBa_K1463030 range2393541 1 63 73 annotation2393540 1 BBa_K1463040 range2393540 1 1 54 annotation2393545 1 BBa_K1463041 range2393545 1 213 267 annotation2393543 1 BBa_B0010 range2393543 1 125 204 BBa_K1463040 1 attP PhiC31 attP site 2014-08-13T11:00:00Z 2015-05-08T01:10:37Z Synthesised by IDT technologies from a given sequence. PhiC31 attP site false false _1842_ 0 23036 9 Not in stock false ... false Beth Greig BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1463040_sequence 1 gagtagtgccccaactggggtaacctttgagttctctcagttgggggcgtaggg BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1463501_sequence 1 gctagcactgtacctaggactgagctagccgtcaa BBa_K1463030_sequence 1 gatccgaagct BBa_K1463041_sequence 1 aggtggagtacgcgcccggggagcccaagggcacgccctggcacccgcaccgcgg BBa_K1463050_sequence 1 gagtagtgccccaactggggtaacctttgagttctctcagttgggggcgtagggtactagaggatccgaagcttactagaggctagcactgtacctaggactgagctagccgtcaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagaggtggagtacgcgcccggggagcccaagggcacgccctggcacccgcaccgcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z