BBa_K1463100 1 BBa_K1463100 GvpA, K737016, RBS 2014-10-03T11:00:00Z 2015-05-08T01:10:37Z ... RBS designed for GvpA, part number K737016. false false _1842_ 0 23036 9 Not in stock false ... false Beth Greig BBa_K1463210 1 BBa_K1463210 GvpA with RBS 2014-10-03T11:00:00Z 2015-05-08T01:10:37Z ... GvpA, part K737016, with RBS, K1463100 false false _1842_ 0 23036 9 Not in stock false ... false Beth Greig component2393612 1 BBa_K1463100 component2393613 1 BBa_K737016 annotation2393612 1 BBa_K1463100 range2393612 1 1 8 annotation2393613 1 BBa_K737016 range2393613 1 15 233 BBa_K737016 1 BBa_K737016 This part conteins gvpA protein's coding sequence. 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes. This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_K737016_sequence 1 atggccgttgaaaaagtaaactcatcctccagtctggccgaagttatcgatcggatcttagataaaggcattgtgattgacgcttgggtacgggtttccctcgttggaatcgagcttctatccatagaagcaagaatcgtgatcgcttctgttgaaacctatctcaagtacgcagaagccgttggtttaaccgcacaggcggctgttccttcggtctaa BBa_K1463100_sequence 1 aaagagaa BBa_K1463210_sequence 1 aaagagaatactagatggccgttgaaaaagtaaactcatcctccagtctggccgaagttatcgatcggatcttagataaaggcattgtgattgacgcttgggtacgggtttccctcgttggaatcgagcttctatccatagaagcaagaatcgtgatcgcttctgttgaaacctatctcaagtacgcagaagccgttggtttaaccgcacaggcggctgttccttcggtctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z