BBa_K1470002 1 BBa_K1470002 Galactose-induced gene 4 DNA binding domain (Gal4DBD) 2014-10-01T11:00:00Z 2015-05-08T01:10:39Z We received it from the AG Weber at the BIOSS Center, Freiburg, Germany. This yeast protein is a positive transcriptional regulator for the gene expression of the galactose-induced genes such as GAL1, GAL2, GAL7, GAL10, and MEL1 which are important for galactose import and conversion to glucose []. It recognizes a 17 base pair sequence in (5'-CGGRNNRCYNYNCNCCG-3') the upstream activating sequence (UAS-G) of these genes.<br> GAL4 is used to investigate gene expressions in several organisms (bacteria, plants, fruit flyes) [].<br> The protein is controlled by a strong promotor. Binding to UAS-G leads to the expression of the corresponding gene. ==References== BRAND, AH., PERRIMON, N.: Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993 Jun;118(2):401-15.<br> TRAVEN, A., JELICIC, B., SOPTA, M.: Yeast Gal4: a transcriptional paradigm revisited. EMBO Rep. May 2006; 7(5): 496???499.<br> false false _1849_ 0 20909 9 In stock false No false Pascal Sartor BBa_K1470002_sequence 1 atgaagctactgtcttctatcgaacaagcatgcgatatttgccgacttaaaaagctcaagtgctccaaagaaaaaccgaagtgcgccaagtgtctgaagaacaactgggagtgtcgctactctcccaaaaccaaaaggtctccgctgactagggcacatctgacagaagtggaatcaaggctagaaagactggaacagctatttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgttaacaggattatttgtacaagataatgtgaataaagatgccgtcacagatagattggcttcagtggagactgatatgcctctaacattgagacagcatagaataagtgcgacatcatcatcggaagagagtagtaacaaaggtcaaagacagttgactgtatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z