BBa_K1470003 1 BBa_K1470003 Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) 2014-10-01T11:00:00Z 2015-05-08T01:10:39Z We received it from the AG Weber at the BIOSS Center, Freiburg, Germany. Retro viral vectors provide an optimal gene delivery system. They are able to transport large DNA fragments and efficiently integrate them stable in the genome. However, high gene expression levels are often absent [1]. <br> It is known that the Woodchuck Hepatitis Virus contains a regulatory RNA sequence, which promotes viral gene expression. When fused downstream to a gene, the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE)creates a tertiary structure, which enhances the export of unspliced mRNA from the nucleus into the cytoplasm [2]. Klein <i>et al.</i> showed, that WPRE boosts gene expression level of enhanced green fluorescent protein (EGFP) or viral titres up to five times [3]. <br> ==References= <small> [1] ZUFFEREY, R., DONELLO, J.E., TRONO, D., HOPE, T.J.: Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element Enhances Expression of Transgenes Delivered by Retroviral Vectors. J Virol. Apr 1999; 73(4): 2886???2892.<br> [2] POPA, I., HARRIS, M.E., DONELLO, J.E., HOPE, T.J.: CRM1-dependent function of a cis-acting RNA export element. Mol Cell Biol. 2002 Apr;22(7):2057-67. [3] KLEINA, R., RUTTKOWSKIB, B., KNAPP, E., SALMONSA, B., GUENZBURG, W.H., HOHENADL, C.: WPRE-mediated enhancement of gene expression is promoter and cell line specific. Gene. 2006 May 10;372:153-61 false false _1849_ 0 20909 9 In stock false We wanted to improve the gene expression of our viral vectors false Pascal Sartor BBa_K1470003_sequence 1 tcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggatctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z