BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1491019 1 BBa_K1491019 Constitutive Killer Red 2014-09-14T11:00:00Z 2015-05-08T01:10:44Z Killer Red is BBa_K1184000, the promoter is BBa_J23100 and the RBS is BBa_B0034 Superoxide generator Killer Red (BBa_K1184000) with a constitutive promoter (BBa_J23100) and a ribosome binding site (BBa_B0034). false false _1871_ 0 22521 9 It's complicated false Constitutive version of Killer Red for performing photobleaching experiments. false Danielle Peters component2383491 1 BBa_B0034 component2383489 1 BBa_J23100 component2383500 1 BBa_K1184000 annotation2383489 1 BBa_J23100 range2383489 1 1 35 annotation2383500 1 BBa_K1184000 range2383500 1 62 784 annotation2383491 1 BBa_B0034 range2383491 1 44 55 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1184000 1 BBa_K1184000 KillerRed 2013-09-03T11:00:00Z 2016-01-25T02:40:37Z Engineered from avGFP. Provided by the Bruchez lab at Carnegie Mellon KillerRed is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). KillerRed is engineered from Aequorea victoria GFP (avGFP) to be phototoxic. It has been shown that KillerRed produces superoxide radical anions by reacting with water. Superoxide reacts with the chromophore of KillerRed, causing it to become dark, which ultimately gives rise to a bleaching effect. KillerRed is spectrally similar to mRFP1 with a similar brightness. KillerRed is oligomeric and may form large aggregates. This sequence is codon optimized for mammalian cells and has 14 rare proline codons for E. coli (CCC) and one rare arginine codon (AGA). Codon optimization should be taken into consideration if large amounts of the protein are required. Expression on a high-copy plasmid has produced detectable fluorescent signal, however. false false _1497_ 4206 12713 9 In stock true This sequence is not codon optimized for E. coli. false Eric Pederson annotation2334960 1 Phototoxic Mutation Asn(147) range2334960 1 439 441 annotation2334953 1 Double Stop range2334953 1 718 723 annotation2334965 1 Phototoxic Mutation Ala(163) range2334965 1 487 489 annotation2334956 1 Phototoxic Mutation Glu(70) range2334956 1 208 210 annotation2334954 1 Start range2334954 1 1 3 annotation2334957 1 Phototoxic Mutation Ser(121) range2334957 1 367 369 annotation2334958 1 Chromophore range2334958 1 199 207 annotation2334955 1 cds range2334955 1 1 717 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1184000_sequence 1 atgggttcagagggcggccccgccctgttccagagcgacatgaccttcaaaatcttcatcgacggcgaggtgaacggccagaagttcaccatcgtggccgacggcagcagcaagttcccccacggcgacttcaacgtgcacgccgtgtgcgagaccggcaagctgcccatgagctggaagcccatctgccacctgatccagtacggcgagcccttcttcgcccgctaccccgacggcatcagccatttcgcccaggagtgcttccccgagggcctgagcatcgaccgcaccgtgcgcttcgagaacgacggcaccatgaccagccaccacacctacgagctggacgacacctgcgtggtgagccgcatcaccgtgaactgcgacggcttccagcccgacggccccatcatgcgcgaccagctggtggacatcctgcccaacgagacccacatgttcccccacggccccaacgccgtgcgccagctggccttcatcggcttcaccaccgccgacggcggcctgatgatgggccacttcgacagcaagatgaccttcaacggcagccgcgccatcgagatccccggcccacacttcgtgaccatcatcaccaagcagatgagggacaccagcgacaagcgcgaccacgtgtgccagcgcgaggtggcctacgcccacagcgtgccccgcatcaccagcgccatcggtagcgacgaggattaataa BBa_K1491019_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgggttcagagggcggccccgccctgttccagagcgacatgaccttcaaaatcttcatcgacggcgaggtgaacggccagaagttcaccatcgtggccgacggcagcagcaagttcccccacggcgacttcaacgtgcacgccgtgtgcgagaccggcaagctgcccatgagctggaagcccatctgccacctgatccagtacggcgagcccttcttcgcccgctaccccgacggcatcagccatttcgcccaggagtgcttccccgagggcctgagcatcgaccgcaccgtgcgcttcgagaacgacggcaccatgaccagccaccacacctacgagctggacgacacctgcgtggtgagccgcatcaccgtgaactgcgacggcttccagcccgacggccccatcatgcgcgaccagctggtggacatcctgcccaacgagacccacatgttcccccacggccccaacgccgtgcgccagctggccttcatcggcttcaccaccgccgacggcggcctgatgatgggccacttcgacagcaagatgaccttcaacggcagccgcgccatcgagatccccggcccacacttcgtgaccatcatcaccaagcagatgagggacaccagcgacaagcgcgaccacgtgtgccagcgcgaggtggcctacgcccacagcgtgccccgcatcaccagcgccatcggtagcgacgaggattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z