BBa_K1500999 1 BBa_K1500999 ParoF promoter 2014-10-16T11:00:00Z 2015-05-08T01:10:47Z Cloned from wild-type DH5-alpha E. coli genomic sequence. Used in BBa_1500001, this promoter drives expression of the AroF promoter in wild-type E. coli. Here, it is used as a tyrosine-repressible promoter sensitive to the transcription factor TyrR. false false _1880_ 0 23136 9 Not in stock false None. false Kevin Yang annotation2422932 1 misc range2422932 1 1 200 BBa_K1500999_sequence 1 ctttttcaaagcatagcggattgttttcaaagggagtgtaaatttatctatacagaggtaagggttgaaagcgcgactaaattgcctgtgtaaataaaaatgtacgaaatatggattgaaaactttactttatgtgttatcgttacgtcatcctcgctgaggatcaactatcgcaaacgagcataaacaggatcgccatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z