BBa_K1503000 1 BBa_K1503000 Cell cycle dependend degradation-tag from S. cerevisia. 2014-10-15T11:00:00Z 2015-05-08T01:10:47Z The gene for the Clb3 protein is to be found in the genome of S. cerevisiae. This degradation-tag, in short D-tag, is a short part of the cyclin Clb3. It is the sequence for the amino acids of the N-terminal until and including a destruction box, a nine amino acid recognition site with the sequence R-x-x-L-x-x-x-x-N. This sequence is necessary but not sufficient for a specific ubiqitin-mediated degradation and to be found in most of the B-cyclins of yeast. Cyclins bind to cell cycle specific kinases and mediate thereby the progress of the different steps of the cell cycle. The six B-cyclins in yeast (Clb1-6) are responsible for the transition into S- and M-Phase of the cell cycle. With increasing digit the degradation occours later in the cell cycle. This goes hand in hand with the position of the destruction box in the protein, which distance to the N-terminal increases with the digit as well. false false _1883_ 0 21213 9 Not in stock false Because of the short length of the fragment the purification is harder, since it has the same size as pollutants might have. false Markus Janasch BBa_K1503000_sequence 1 atgcatcataactcacagtctttgagctctggacacatcaggagccccgaggatgaaaatgtggcacctataggtaatcttaaacacaggactggatccctcagtcatatttcatctgcgcacccgagggtcgcacttagcgacgttaccaatatagttgcgaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z