BBa_K1510003 1 BBa_K1510003 Pcon (S.mutans) 2014-10-05T11:00:00Z 2015-05-08T01:10:47Z Streptococcus mutans UA159 This part is derived from Streptococcus mutans UA159. The main function of this promoter is to trigger downstream gene continually. false false _1890_ 0 21272 9 In stock false In order to maintain the complete function of this promoter, RBS is retained when amplifying the sequence with PCR. Consequently, the part consists of one constitutive promoter and RBS. false Yen-An Chang BBa_K1510003_sequence 1 ttgttttattattagaaaggtgttacaattataacgttttgaataaaacagtttaaaatttggaggttccta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z