BBa_K1510930 1 BBa_K1510930 Constitutive promoter and RBS region for Streptococcus mutans transcription. 2014-10-09T11:00:00Z 2015-05-08T01:10:48Z The constitutive promoter and RBS region is obtained from the genome of Streptococcus mutans by self-designed PCr primers. We are going to express the luxI gene which would code for the AHL quorum sensing signal in Streptococcus mutans. The goal is to let the engineered probiotics with luxR protein bind with AHL and yield the downstream expression of S.mutans killing module. false false _1890_ 0 21745 9 In stock false The promoter and RBS region would only be in need in the functional measurement stage of our project so that we could test whether the S.mutans with luxI gene below our constitutive promoter and RBS region could normally express the quorum sensing signal AHL or not. Whereas, in the working circuit, this promoter and RBS region won't be added because the luxI gene and its terminator are ligated to a complete sequence with CSP-sensing promoter region. false Wang,Ching-Yun BBa_K1510930_sequence 1 ttgttttattattagaaaggtgttacaattataacgttttgaataaaacagtttaaaatttggaggttccta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z