BBa_K1519123 1 BBa_K1519123 OsmY based secretion for purification 2014-10-08T11:00:00Z 2015-05-08T01:10:48Z OsmY comes from the MG1655 E.coli strain. By inserting the DNA sequence of a desired protein in our part, you will be able to secret your protein, bind it to a Nickel column, and cleave off the desired protein from the tag in very few steps. The OsmY-tag will allow you to have your protein fold in the periplam and form disulfide bonds. Once folded OsmY also allows the portein to be secreted into the media, which contains significantly less portion of endesired protein. The media containing the construct can there be run through a nickel column for further purification. Once elluted from the column, one can add TEV-His protease to cleave the tag off the desired protein. By re-running the protein in a nickel column, the desired portein will elute directly, while the tag and the TEV-His will stay bound to the column. false false _1901_ 0 18972 9 It's complicated false None. false Raoul Martin, Drew Dunham component2408328 1 BBa_J18918 component2408319 1 BBa_I712074 component2408321 1 BBa_B0034 component2408325 1 BBa_K243004 component2408327 1 BBa_K157011 component2408323 1 BBa_K892008 annotation2408319 1 BBa_I712074 range2408319 1 1 46 annotation2408328 1 BBa_J18918 range2408328 1 733 753 annotation2408323 1 BBa_K892008 range2408323 1 73 678 annotation2408321 1 BBa_B0034 range2408321 1 55 66 annotation2408327 1 BBa_K157011 range2408327 1 707 724 annotation2408325 1 BBa_K243004 range2408325 1 687 698 BBa_K892008 1 osmY osmY 2012-09-29T11:00:00Z 2015-05-08T01:13:41Z E. coli genome Osmotically induced protein Y shown to have exporting capabilities when fused to other proteins false false _1156_ 0 10541 9 In stock true None for now. false David Zong, Felix Ekness annotation2207571 1 osmY range2207571 1 1 606 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_K157011 1 His His affinity tag; Freiburg standard 2008-10-25T11:00:00Z 2015-05-08T01:10:54Z Gene synthesis by ATG:biosynthetics, optimized for expression in homo sapiens by iGEM-Team Freiburg 2008 His-tag; fusion to proteins facilitates detection, purification, immobilization; NgoMIV / AgeI protein fusion part. false true _232_ 0 1673 9 It's complicated false Between BioBrick 1.0 sites this part is flanked 5' by NgoMI(=NgoMIV) and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions. true Kristian M??ller annotation2040626 1 His-Tag range2040626 1 1 18 BBa_J18918 1 TEVsite TEV cleavage site (E. coli) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis TEV cleaves the following AA sequence with high specificity: * Glu-Asn-Leu-Tyr-Phe-Gln&#8595;Gly but: * Glu-Asn-Leu-Tyr-Phe-Gln&#8595;Ser is also reported Note, the part suggested by the Voigt lab, also contains 2 additional 1xGly flanks for increased accessibility. See also: * BBa_I712077 (TEV N-term) * BBa_I712078 (TEV C-term) * BBa_I712016 (myri+TEV site, Slovenia team igem2007) * BBa_J64007 (Dan Widmaier, Voigt lab) References =========== Dougherty et al. (1989): Molecular genetic analysis of a plant virus polyprotein cleavage site: a model. PMID: 2669323 false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K243004 1 ShortLinke Short Linker (Gly-Gly-Ser-Gly) 2009-10-11T11:00:00Z 2015-05-08T01:11:37Z Oligos synthesized by sigma. Hybridized by PCR. This linker was used to connect two different parts. The sequence produced the aminoacids Gly-Gly-Ser-Gly. false true _352_ 0 4732 9 In stock false None. false Freiburg Bioware09 annotation2041881 1 Short Linker range2041881 1 1 12 BBa_K892008_sequence 1 atgactatgacaagactgaagatttcgaaaactctgctggctgtaatgttgacctctgccgtcgcgaccggctctgcctacgcggaaaacaacgcgcagactaccaatgaaagcgcagggcaaaaagtcgatagctctatgaataaagtcggtaatttcatggatgacagcgccatcaccgcgaaagtgaaggcggccctggtggatcatgacaacatcaagagcaccgatatctctgtaaaaaccgatcaaaaagtcgtgaccctgagcggtttcgttgaaagccaggcccaggccgaagaggcagtgaaagtggcgaaaggcgttgaaggggtgacctctgtcagcgacaaactgcacgttcgcgacgctaaagaaggctcggtgaagggctacgcgggtgacaccgccaccaccagtgaaatcaaagccaaactgctggcggacgatatcgtcccttcccgtcatgtgaaagttgaaaccaccgacggcgtggttcagctctccggtaccgtcgattctcaggcacaaagtgaccgtgctgaaagtatcgccaaagcggtagatggtgtgaaaagcgttaaaaatgatctgaaaactaagtaa BBa_K1519123_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggagaaatactagatgactatgacaagactgaagatttcgaaaactctgctggctgtaatgttgacctctgccgtcgcgaccggctctgcctacgcggaaaacaacgcgcagactaccaatgaaagcgcagggcaaaaagtcgatagctctatgaataaagtcggtaatttcatggatgacagcgccatcaccgcgaaagtgaaggcggccctggtggatcatgacaacatcaagagcaccgatatctctgtaaaaaccgatcaaaaagtcgtgaccctgagcggtttcgttgaaagccaggcccaggccgaagaggcagtgaaagtggcgaaaggcgttgaaggggtgacctctgtcagcgacaaactgcacgttcgcgacgctaaagaaggctcggtgaagggctacgcgggtgacaccgccaccaccagtgaaatcaaagccaaactgctggcggacgatatcgtcccttcccgtcatgtgaaagttgaaaccaccgacggcgtggttcagctctccggtaccgtcgattctcaggcacaaagtgaccgtgctgaaagtatcgccaaagcggtagatggtgtgaaaagcgttaaaaatgatctgaaaactaagtaatactagagggtggttctggttactagagcatcatcatcatcatcattactagaggaaaacctgtattttcagggc BBa_K243004_sequence 1 ggtggttctggt BBa_B0034_sequence 1 aaagaggagaaa BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_K157011_sequence 1 catcatcatcatcatcat BBa_J18918_sequence 1 gaaaacctgtattttcagggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z