BBa_K1539021 1 HE RBS HE RBS Primer 2014-10-09T11:00:00Z 2015-05-08T01:10:52Z Primer ordered from IDT This primer can be used to insert a high efficiency RBS to transcribe coding sequences starting with ATG in E. coli. false false _1921_ 0 23019 9 Not in stock false Needed to design the primer so that the annealing temperature for PCR was 60 degrees Celsius false Coleen Tran BBa_K1539021_sequence 1 tggaattcgcggccgcttctagagaaagagaggaatgtactagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z