BBa_K1583060 1 BBa_K1583060 Hydroxyapatite affinity tag 2015-09-07T11:00:00Z 2015-09-08T04:31:43Z The sequence was obtained from the paper "Identification of a Highly Specific Hydroxyapatite-binding Peptide using Phage Display" [1] 1. M. Roy, S. Stanley, E. Amis, M. Becker, Adv. Mater., 2008, 20, 1830-1836. This part generates a peptide tag which shows high adhesive properties towards hydroxyapatite, a main component of teeth. false false _2000_ 24463 24463 9 false No specific design considerations were made. false Stefan Robert Marsden annotation2473127 1 Hydroxyapatite-affinity tag range2473127 1 1 39 BBa_K1583060_sequence 1 tctgtttctgttggtatgaaaccgtctccgcgtccgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z