BBa_K1592013 1 Si-tag1+li LIP prepro + E. coli ribosomal protein L2 (1-60,GS linker,202-273aa) + YLcwp3 2015-09-07T11:00:00Z 2015-09-18T09:36:35Z E. coli ribosomal protein L2 was synthesized by IDT, LIP2 prepro and YLcwp3 were cloning from the plasmid JMP62, and we fused this three sequences. __NOTOC__ <partinfo>BBa_K1592008 short</partinfo> This is the cell display system of Yarrowia lipolytica, composed of LIP prepro, interest protein, and YLcwp3.LIP prepro is signal peptide used to secrete the interest protein out of the cell, and the YLcwp3 is the anchor domain binding the interest protein to the cell wall of yeast.We use this system to display silica-tag and test its binding characteristics. Here we use this system to display Silica-tag on cell wall of Yarrowia lipolytica to binding the silica. E.coli ribosomal protein L2 was found to bind tightly to silicon particles, which have surfaces that are oxidized to silica. This L2 silica-binding tag, called the 'Si-tag', can be used for one-step targeting of functional proteins on silica surfaces. The silica-binding domains of E. coli L2 was mapped to amino acids 1???60, 61-202 and 203???273, called Si-tag1, Si-tag2 and Si-tag3. We respectively test the silica-binding characteristics of this three regions and their combinations. false false _2009_ 20267 20267 9 true In order to replace the domains more conveniently, we respectivey added BamHI, SalI, NdeI between LIP2 prepro, E. coli ribosomal protein L2, GS linker and YLcwp3 false Shuyan Tang annotation2456174 1 YLcwp3 range2456174 1 592 957 annotation2456173 1 NdeI range2456173 1 586 591 annotation2456170 1 Si-tag 1L3 range2456170 1 124 534 annotation2456168 1 BamHI range2456168 1 100 105 annotation2463874 1 GS Linker range2463874 1 304 318 annotation2456171 1 SalI range2456171 1 535 540 annotation2456166 1 LIP2 prepro range2456166 1 1 99 annotation2456169 1 His6 tag range2456169 1 106 123 annotation2456172 1 GS Linker range2456172 1 541 585 BBa_K1592013_sequence 1 atgaagctttccaccatccttttcacagcctgcgctaccctggctgccgccctcccttcccccatcactccttctgaggccgcagttctccagaagcgaggatcccaccaccaccaccaccacatggcagttgttaaatgtaaaccgacatctccgggtcgtcgccacgtagttaaagtggttaaccctgagctgcacaagggcaaaccttttgctccgttgctggaaaaaaacagcaaatccggtggtcgtaacaacaatggccgtatcaccactcgtcatatcggtggtggccacaagcagggtggcggaggttcacgcgttctgggtaaagcaggtgctgcacgctggcgtggtgttcgtccgaccgttcgcggtaccgcgatgaacccggtagaccacccacatggtggtggtgaaggtcgtaactttggtaagcacccggtaactccgtggggcgttcagaccaaaggtaagaagacccgcagcaacaagcgtactgataaattcatcgtacgtcgccgtagcaaataagtcgacggcggcggcggctctggcggcggcggctctggcggcggcggctctcatatgctcggctttgccgctcgagctgtcttcgaaggtggctcttcttccgccgctgctcccacctcttcctccgctgcttcccatgccgcctcttccgctgccgcctctgcttctcacgctgcttcttctgctgctgcttccaaggcttcttctgctgttgccgcccccaagtccgaggccgctgctggtgctcacgccactgccggtgccattgtctcccagatcaatgatggccagatccaggctccccactccaccggccctgcccaggcccccaaggcctctgctcctcccgcccaggccaacggcgctgccacccttggtgtctctgctgttgccggtgctgttgccgtcgccatgcttttctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z