BBa_K950002 1 BBa_K950002 yeast anb1 promotor 2012-07-28T11:00:00Z 2015-05-08T01:13:48Z sequence and information from http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=SUC2 This is the promotor of yeast anb1 gene. Panb1 is a target of the rox1 repressor. false false _1218_ 0 11576 9 In stock false genomic sequence was not altered false Jakob Matthes annotation2179269 1 rox1 binding site range2179269 1 88 93 annotation2179270 1 rox1 binding site range2179270 1 186 191 BBa_K1592019 1 BBa_K1592019 Panb1+XPR2 pre-Mcfp3 2015-09-08T11:00:00Z 2015-09-18T08:58:42Z The sequence of Panb1 and XPR2 pre-Mcfp3 is synthesized by IDT, and we assembled them by 3A assembly method. This is one of the components of Flocculate system. The XPR2-Mcfp3 is under the control of Panb1, which is a target of the ROX1 repressor Mcfp-3 is foot protein secreted from Mytilus californianus. Its coherent substance shows the excellent adhesion performance with no substitute under water for sustaining the repeating wash of waves and having no toxicity. The signal tag, XPR2 fused to Mcfp3 can lead the co-translational translocation of heterologous protein Mcfp-3 to be secreted out of the cell to achieve its function, during the progress of which the peptide will be deleted in the Golgi apparatus to eliminate the interference to the secreting protein. false false _2009_ 20267 20267 9 false none false Shuyan Tang component2447794 1 BBa_K1592017 component2447793 1 BBa_K950002 annotation2447794 1 BBa_K1592017 range2447794 1 406 684 annotation2447793 1 BBa_K950002 range2447793 1 1 399 BBa_K1592017 1 BBa_K1592017 Mcfp3 with XPR2 pre 2015-09-08T11:00:00Z 2015-09-09T07:26:33Z Synthesized by IDT. Mcfp-3 is foot protein secreted from Mytilus californianus. The protein is of significance to the formation of byssus to help mussels permanently or temporarily tether to the surface of solid surface of reef or ship-body. This coherent substance shows the excellent adhesion performance with no substitute under water for sustaining the repeating wash of waves and having no toxicity. XPR2 pre is the pre-region corresponds to the signal sequence: the dipeptides XA and XP are substrates for diamino-peptidase; the dibasic KR cleavage site is substrate for Xpr6p endoproteinase (Matoba and Ogrydziak, 1989). The signal tag, XPR2 fused to Mcfp3 can lead the co-translational translocation of heterologous protein Mcfp-3 to be secreted out of the cell to achieve its function, during the progress of which the peptide will be deleted in the Golgi apparatus to eliminate the interference to the secreting protein. false false _2009_ 20267 20267 9 false none false Shuyan Tang annotation2456116 1 XPR2 signal peptide range2456116 1 1 45 annotation2456118 1 start range2456118 1 46 48 annotation2456117 1 MCFP3 range2456117 1 46 279 annotation2456119 1 stop range2456119 1 277 279 BBa_K950002_sequence 1 ttttttcctgtgttcacctttttttttttcagttgacatctttctgcattcttttctgtgtttttttttttttttttcgtttttccattgttcgttcgttgcctgttttttcgccctattgttctcgagcctaaaaattttttcctttcctgctttcctttcttcgttcaaagtttcctattccattgttctctttggtaaactcattgttgtcggaactcagatatattcaggtcaatttactgtacttcaattgacttttttcttgaaatttcaacttgccttttcaacttgttcttcttttttaatcttattctacactttagttcccttaccttgttcctaattattgtctagcaaaaagaaaacatacacctatttcattcacacactaaaaca BBa_K1592019_sequence 1 ttttttcctgtgttcacctttttttttttcagttgacatctttctgcattcttttctgtgtttttttttttttttttcgtttttccattgttcgttcgttgcctgttttttcgccctattgttctcgagcctaaaaattttttcctttcctgctttcctttcttcgttcaaagtttcctattccattgttctctttggtaaactcattgttgtcggaactcagatatattcaggtcaatttactgtacttcaattgacttttttcttgaaatttcaacttgccttttcaacttgttcttcttttttaatcttattctacactttagttcccttaccttgttcctaattattgtctagcaaaaagaaaacatacacctatttcattcacacactaaaacatactagatgaagctcgctaccgcctttactattctcacggccgttctggccatgaataaattcagtgtcacagttttgctggctttagtccttattggattttttgccgttcagagtgacgcaggttatggttatgatctaggatataatgcaccatggccatacaacaatggttactatggctataatggatacaatggatatcacggacgttatggctggaataaaggctggaataacggtccatggggaggatcatattatggaaacaaaggctatttgtat BBa_K1592017_sequence 1 atgaagctcgctaccgcctttactattctcacggccgttctggccatgaataaattcagtgtcacagttttgctggctttagtccttattggattttttgccgttcagagtgacgcaggttatggttatgatctaggatataatgcaccatggccatacaacaatggttactatggctataatggatacaatggatatcacggacgttatggctggaataaaggctggaataacggtccatggggaggatcatattatggaaacaaaggctatttgtat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z