BBa_K1616008 1 HokD-rev HokD reversed 2015-09-16T11:00:00Z 2015-09-17T01:09:35Z This part is the reversed sequence of the HokD from BBa_K1497008. The HokD protein is a toxin when overexpressed kills the cells from the inside by interfering with a vital function in the cell membrane. It has been shown that the hokD gene can be used to design efficient suicide functions to contain bacterial growth (Knudsen and Karlstrom 1991, Knudsen, Saadbye et al. 1995) false false _2033_ 22805 22805 9 false Illegal sites have been checked. false Johanna Chesnel annotation2466778 1 HokD reversed range2466778 1 1 156 BBa_K1616009 1 HokD-rev HokD reversed - RBS and double T7 terminator 2015-09-16T11:00:00Z 2015-09-17T01:09:07Z This composition part is composed of reversed sequence of the HokD from BBa_K1616008, and RBS reversed BBa_K1616011 and the double terminator T7 reversed BBa_B0025. The HokD protein is a toxin when overexpressed kills the cells from the inside by interfering with a vital function in the cell membrane. It has been shown that the hokD gene can be used to design efficient suicide functions to contain bacterial growth (Knudsen and Karlstrom 1991, Knudsen, Saadbye et al. 1995) false false _2033_ 22805 22805 9 false The presence of illegal site have been checked. false Johanna Chesnel component2466841 1 BBa_B0025 component2466843 1 BBa_K1616008 component2466845 1 BBa_K1616011 annotation2466841 1 BBa_B0025 range2466841 1 1 129 annotation2466845 1 BBa_K1616011 range2466845 1 302 315 annotation2466843 1 BBa_K1616008 range2466843 1 138 293 BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369703 1 B0010 range369703 1 50 129 annotation369702 1 B0012 range369702 1 1 41 BBa_K1616011 1 RBS-rev RBS reversed 2015-09-16T11:00:00Z 2015-09-17T10:56:58Z This part is the reverse sequence of the BBa_I712074 promoter T7. For more efficiency of construction, scientists use more and more reversed promoter and then reversed sequences of proteins coding. This part have been created in order to recruit transcriptional machinery and lead to transcritpion of the upstream DNA sequence. So, this part is the reverse sequence of the BBa_I712074 promoter T7. false false _2033_ 22805 22805 9 false We have checked that any illegal sites was formed. false Johanna Chesnel annotation2466086 1 RBS Reversed range2466086 1 1 14 BBa_K1616009_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggtactagagttactcctcaggttcgtaagctgtgaagacagcgacctccgtctggccggttcggattcgtacctcgcagaggtctttcctcgttaccagtgccgtcactatgacggttaaacagatgacgatcagggcgattaacatcgccttttgctgcttcattactagagttgtcccctctttc BBa_K1616008_sequence 1 ttactcctcaggttcgtaagctgtgaagacagcgacctccgtctggccggttcggattcgtacctcgcagaggtctttcctcgttaccagtgccgtcactatgacggttaaacagatgacgatcagggcgattaacatcgccttttgctgcttcat BBa_K1616011_sequence 1 ttgtcccctctttc BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z